اسلاید پاورپوینت: هشاشه العظام ، الجینات التی و اهم الجینات…


عناوین اصلی استخراج شده از این فایل پاورپوینت

عناوین اصلی استخراج شده از این فایل پاورپوینت

● نشره علمیه
● الأسباب الجینیه و الهرمونیه لهشاشه العظام
● مقدمه
● هشاشه العظام
● اللص الصامت
● أنواع هشاشه العظام
● أسباب الحدوث
● العامل الجینی
● العوامل الوراثیه
● دعونا نستعرض أهم الجینات التی تلعب دوراً فی إحداث الهشاشه
● أهم الجینات التی تلعب دوراً فی إحداث الهشاشه
● هل یمکن إستخدام الهرمونات البدیله

نوع زبان : عربی حجم : ۱٫۷ مگا بایت
نوع فایل : اسلاید پاورپوینت تعداد اسلایدها: ۲۷ صفحه
زمان استخراج مطلب : ۲۰۱۸/۱۱/۰۲ ۰۸:۱۵:۵۴ پسوند فایل : ppt

لینک دانلود رایگان لینک دانلود کمکی


در صورتی که محتوای فایل ارائه شده با عنوان مطلب سازگار نبود یا مطلب مذکور خلاف قوانین کشور بود لطفا در بخش دیدگاه (در پایین صفحه) به ما اطلاع دهید. جهت جستجوی پاورپوینت های بیشتر بر روی اینجا کلیک کنید.

این مطلب در تاریخ ۲۰۱۸/۱۱/۰۲ ۰۸:۱۵:۵۴ به صورت خودکار استخراج شده است. در صورت اعلام عدم رضایت تهیه کننده ی آن، طبق قوانین سایت از روی وب گاه حذف خواهد شد. همچنین این مطلب برگرفته از وب سایت زیر است و مسئولیت انتشار آن با منبع اصلی است.


بخشی از محتوای متن استخراج شده از این فایل ppt

بخشی از محتوای متن استخراج شده از این فایل ppt

نشره علمیه الوحده العلمیه و الفنیه فی المختبر المرکزی د. مها حسن عبدالعزیز داغستانی أ. غدیر منیر العتیبی الأسباب الجینیه و الهرمونیه لهشاشه العظام مقدمه فی الحیاه العصریه الحدیثه بکل ما یحیط بها من سلوک غذائی وعوامل بیئیه دخل مرض هشاشه العظام ضمن قائمه الأمراض التی باتت تقلق الإنسان کلما تقدمت به أیام العمر، خاصه أن المرض یتسلل إلى العظام دون اعطاء اشارات واضحه بقدومه. هشاشه العظام تعنى کلمه ترقق العظام هشاشه العظام الفقدان التدریجى لکتله العظام مما یجعلها ضعیفه و عرضه للکسر بسهوله ، لذا سمى أیضاً هشاشه العظام او اللص الصامت. اللص الصامت هشاشه العظام مرض صامت حقا، لا تظهر اعراضه الا بعد تقدمه کثیرا، اذ ان الانخفاض فی کثافه العظام لا یولد أی اعراض الى حین وصول قیمتها الى اقل من القیمه التی تعرض العظام للتکسر بسهوله . وحتى وعند وصولها الى ذلک الحین، فان هشاشه العظام تظل غالبا مرضا من دون آلام حتى الوقت الذی تتعرض فیه العظام الناعمه الى للاصطدام بأشیاء صلب تؤدی إلى کسرها. ولدى الرجال، کما للنساء، فان کسر العمود الفقری هو اکثر النتائج الشائعه لهشاشه العظام. والتناقص التدریجی للطول ربما یکون الدلیل الأوحد على انضغاط عظام الفقرات. الا ان آلام الظهر شائعه کذلک وقد تکون حاده جدا. وفی الحالات المتقدمه للمرض فان وضعیه الانتصاب المنحنیه المعهوده و الخصر البارز بشیران الى وجود کسر فی العمود الفقری بسبب هشاشه العظام. ولدى النساء تسمى هذه التشوهات حدبه دواغر dowager s hump. ورغم انها مشکله تحدث لدى الرجال أیضاً، الا انه لا یوجد مسمى رجالی خاص بها. أنواع هشاشه العظام مرض هشاشه العظام یقسم إلى نوعین أولها یشمل اختزالا سریعا فی کتله العظام ویحدث لدى السیدات بعد انقطاع الدوره الشهریه نتیجه لنقص هرمون الاستروجین فی الجسم. النوع الثانی یسمى هشاشه العظام فی سن الشیخوخه ویحدث نتیجه طبیعیه للتقدم فی العمر. یحدث فی هذا النوع اختزال تدریجی فی کتله العظام کما یرجع إلى حدوث اختزال فی عدد ووظیفه الخلایا التی تبنی العظام وکذلک فی نشاط عملیه بناء العظام فی سن الشیخوخه أسباب الحدوث هناک العدید من الأسباب التى تؤدى إلى ظهور ترقق العظام ، وهناک فئات من الناس أکثر عرضه من غیرهم للإصابه بالمرض ، ومن هذه الأسباب أسباب هرمونیه اسباب غذائیه أسباب جینیه إن هشاشه العظام خطر یحدق بشکل خاص بالنساء بعد سن الیأس والنساء اللواتی دخلن فی سن مبکر للیأس والنساء اللواتی خضعن لعملیه استئصال المبیضین او تعرضن لعلاج اشعاعی لمنطقه اسفل البطن والحوض او عانین لفتره طویله من تدنی مستویات الإستروجین، کما أن هناک عوامل أخرى یحتمل ان تزید من قابلیه تعرضهن لهذا المرض منها العامل الجینی التاریخ المرضی للعائله فهشاشه العظام حاله تمیل للتوارث ضمن نطاق العائلات وهی تلاحظ وجودها بنسب اکبر فی النساء القوقازیات والآسیویات أکثر من الشعوب الأخرى. هل تعرفین شجره عائلتک أو بمعنى أدق هل تعرفین تاریخ عائلتک المَرَضی فلتعلم جیداً أن هناک أمراض تصیبک من أبویک معاً وذلک ما أثبتته الدراسات الحدیثه . ویقسم الأطباء هذه الأمراض إلى أمراض تنتقل عبر الأم وأخرى عبر الأب الأم …..إذا کانت والدتک تحمل الأمراض التالیه فمن المحتمل إصابتک بها انقطاع الطمث المبکر عاده ما ترث الإبنه هرمونات وجینات الأم ومنها تلک الهرمونات التی تحدد مده الدوره الشهریه وموعد انقطاعها ونظراً لخطوره انقطاع الطمث المبکر على صحتک حیث إنه یؤدی للإصابه بالسکته الدماغیه وأمراض القلب وهشاشه العظام . آلام الدوره الشهریه غالباً ما ترث الفتاه الهرمونات المتعلقه بالدوره الشهریه من والدتها ومن ثم تکون آلامها وراثیه. سرطان الثدی نظراً لتوارث الجینات التی تحملها الأورام السرطانیه للأبناء فعلى الفتاه التی تصاب أمها بهذا المرض إجراء فحص سنوی للتأکد من سلامتها بعد بلوغها الثلاثین من العمر العوامل الوراثیه العوامل الوراثیه التی تفسر نحو ۸ فی المائه من اختلافات قیم قمه کثافه العظام. وتفسر العوامل الوراثیه ظهور مرض هشاشه العظام فی عائلات دون غیرها، کما تفسر انتشاره بین اعراق السلالات المتحدره من القوقاز، ومن آسیا، اکثر من انتشاره بین ذوی البشره السوداء. a. wild type tgccatcacgtggtgagtcc b. heterozygous tgccatcangtggtgagtcc c. homozygous tgccatcatgtggtgagtcc ترتبط التغیرات الشکلیه فی الجین بظهور مرض الهشاشه دعونا نستعرض أهم الجینات التی تلعب دوراً فی إحداث الهشاشه أهم الجینات التی تلعب دوراً فی إحداث الهشاشه ویبدو ان الجین الذی ینظم نشاط فیتامین دی هو الاکثر اهمیه، وهذا أمر مقبول لأن فیتامین دی یساعد الامعاء على امتصاص الکالسیوم من الدم. جین الکولاجین النوع الأول ά۱ collagen type ۱ α۱ یعتبر هذا الجین من اهم الجینات التی تلعب دور فی إحداث الهشاشه حیث ان البروتین الذی یشفره الجین أحد أهم البروتینات المکونه للعظام. جین مستقبل هرمون اللإستروجین esr۱ gene و هو اللجین المسئول عن تکوین مستقبلات الهرمون. transforming growth factor beta ۱gene lipoprotein receptor related protein ۵ gene لنلقی نظره سریعه على الهرمونات التی تفرزها الغدد الصماء فی جسمنا یلعب هرمون النمو دور فعالاً فی نمو العظام هرمون الکالسیتونین المفرز من الغده الدرقیه و الهرمون المفرز من الغده الجار درقیه یلعبان دوراً فی المحافظه على مستوى الکالسیوم فی الدم النقص الهرمونی ان ای حاله تسبب فی انخفاض مستویات الاستروجین تسرع فی خساره الکتله العظمیه وهذا یکون واضحاً فی حالات اضطرابات التبویض المزمن کما یحدث فی حالات التکیسات المتعدده للمبیضین وفی حالات اضطرابات هرمونات الغذه الدرقیه. هل یمکن إستخدام الهرمونات البدیله یمکن للهرمون البدیل المتکون من خلیط من هرمونی الإستروجین و البروجسترون أن یحمی المرأه من هشاشه العظام لکن وجد العلماء فی دراسه اجریت على ۱ إمرأه یستخدمن الهرمون البدیل إزدیاد نسبه الإصابه بسرطان الثدی تجلط الدم أمراض القلب السکتات الدماغیه التشکیل الناقص للکتله العظمیه وهذا اکثر عوامل الخطر اهمیه. فاذا لم تکن هناک اصلاً کتله عظمیه کافیه فإن تأثیرات هشاشه العظام تظهر بسرعه وفی مرحله مبکره. ماأجمل القول المأثور … … … … إذا عافاک فقد أغناک اللهم إنی أسألک العفو والعافیه و المعافاه الدائمه فی الدین و الدنیا والآخره و الفوز بالجنه و النجاه من النار … …. فلنحافظ على نعمه الصحه و العافیه بنمط حیاه مثالی یتسم بغذاء صحی متوازن بنشاط بدنی بوزن مثالی بسعاده داخلیه وقناعه و رضى و عطاء بکل هذه …

کلمات کلیدی پرکاربرد در این اسلاید پاورپوینت: هشاشه العظام, الجینات التی, اهم الجینات, هل تعرفین, اللص الصامت, دورا فی, احداث الهشاشه, اهم الجینات التی, مرض هشاشه العظام, مرض هشاشه, العظام فی, التی تلعب, الجینات التی تلعب, الدوره الشهریه,

این فایل پاورپوینت شامل ۲۷  اسلاید و به زبان عربی و حجم آن ۱٫۷ مگا بایت است. نوع قالب فایل ppt بوده که با این لینک قابل دانلود است. این مطلب برگرفته از سایت زیر است و مسئولیت انتشار آن با منبع اصلی می باشد که در تاریخ ۲۰۱۸/۱۱/۰۲ ۰۸:۱۵:۵۴ استخراج شده است.


  • جهت آموزش های پاورپوینت بر روی اینجا کلیک کنید.
  • جهت دانلود رایگان قالب های حرفه ای پاورپوینت بر روی اینجا کلیک کنید.

پاسخی بگذارید

نشانی ایمیل شما منتشر نخواهد شد. بخش‌های موردنیاز علامت‌گذاری شده‌اند *